• 专利附录
  • 专利说明
  • 权利要求
  • 类似技术
  • 同族专利
  • 引用文献
  • 法律状态
  • 优先权
    • 专利摘要:

    公开号:SU1834904A3
    申请号:SU884356123
    申请日:1988-05-26
    公开日:1993-08-15
    发明作者:Bollen Aleks；Gober Zhan；Vyulfert Ernst
    申请人:Ucb Sa；
    IPC主号:
    专利说明:

    The invention relates to a method for producing a new sequence of deoxyribonucleic acids (DNA) containing a fragment encoding human proapolypoprotein A-1.
    Human apolipoprotein A-1 (apo A-1) is the main protein component of high density lipoproteins (LHD) and lymph chylomicrons. The liver and small intestine are the main centers for the synthesis of apo A-1, Apo A-1 is synthesized in these organs in the form of a protein precursor (preproapo A-1), Joint translational cleavage of the prepeptide occurs inside the cell, and proapo A-1 is secreted in plasma and lymph.
    Proapo A-1 contains six additional amino acids (Arg-His-Phe-TrpGln-GIn), which are attached to the terminal amino group of apo A-1. Having reached the region of the location of the vessels, proapo A-1 is cleaved under conditions of an in vivo specific proteolytic enzyme (apo A-1 propeptidase), forming a mature apo A-1,
    This mature apo A-1 is a unique non-glycosylated polypeptide known in the art of food, consisting of 243 amino acids (N.V. Brewer et al. Biochem Biophys. Res. Commun 80, 1978, p. 623-630): It serves as a cofactor for the plasma enzyme licitin: cholesterol acyltransferase. which is responsible for the formation in plasma of most cholesterol esters. Defects in the structure or biosynthesis of apolipoprotein can lead to a disruption in the plasma lipid transport system and to the development of coronary artery disease. Low
    1834904 AZ plasma concentrations of apo A-1 and LHD constitute a significant risk factor for heart attacks (myocardial infarction) and for other diseases associated with vascular atherosclerosis. In particular, mutations in the gene encoding apo A-1 are associated with a decrease in LHD concentration, as well as premature coronary artery disease. Apo A-1 and LHD are the main components of plasma that are involved in the transfer of peripheral tissue (arteries) cholesterol to the liver (also called cholesterol reverse transfer), being extruded by the body. ; Considering that the accumulation of cholesterol in the arteries is the most important feature and mechanism of atherosclerosis, stimulation of cholesterol reverse transfer through apo A-1 can slow down and transform the atherosclerotic process and thereby reduce the incidence of heart attacks.
    The maturation of proapo A-1 in alo A-1 can be quantified outside the cell as it is in the blood for less than 12 hours. Considering that proapo A-Ι is the main, if not the only, precursor of mature apo A-1, it can be used in replacement therapy every time the LHD concentration decreases, for example, with hereditary or acquired defects. In view of the therapeutic value of apo A-1, researchers have attempted to develop methods that allow the production of apo A-1 in large quantities. Such well-known methods include purification of apo A-1 obtained in blood plasma.
    From publications (R. Cheung and L. Chen, Nucleic Acids Res., 11. 1983, 3703-3715: JJ. Sellhamerw et al., DMA, 3.1984, 309-317, and Japanese Patent Application No. 96998 / 86) is known to be complementary to DNA. encoding preproapo A-1, can be obtained by genetic methods.
    So, R. Lorenzetti et al. (FEBS lett 194, 1986, 343-346) showed that apo D-1 can be expressed in E. coll in the form of a protein fused to non-cleavable beta-galactosidase. However, attempts to express mature apo A-1 in the form of a non-fused protein were unsuccessful. Japanese Patent Application No. 96998/86 describes the expression of a protein similar to the human apolipoprotein A-1, E, coll., Which is transformed with plasmid pNA1E-1 containing the gene with the apo A-1 structure, under the control of the tac promoter. However, this structural gene is incomplete and consists of codons of amino acids from +4 to +243, which are preceded by the ATG codon of translation initiation. As a result, the resulting depression product contains N-terminal methionine (corresponding to the ATG codon), which can cause side effects when used in therapy.
    The invention relates to a method for producing human proapolipoprotein AI, that is, the mature proapo A-1 protein, which is capable of being cleaved by the specific proteolytic enzyme proleptidase apo A-1. Under the term mature, used in this context, there is not only human proapo A-1 as such, but also the corresponding protein, the first amino acid of which is methionine, and the presence of which is due to the ATC translation initiation codon in constructing the expression vector.
    Thanks to this production method, human proapo A-1 is completely freed from conventional endogenous proteins and other starting materials or products.
    The invention relates to a method for producing a DNA sequence containing a fragment encoding human pro-apolipoprotein A-1, comprising obtaining DNA clones by cloning a double-stranded complementary DNA into PBR322, selecting a clone encoding preproapolipoprotein A-1, isolating a DNA sequence from a selected clone, and characterized in that in order to ensure the best expression of human proapolipoprotein A-1, using DNA
    - T4 ligases, bind fragment D N K Bal 1
    - Pst1, encoding amino acids +15 to +243 of preproapolipoprotein A-Ι, at the end of a synthetic fragment having a DNA sequence (single chain indicated):
    5-ATGAGACATTTCTGGCAGCAGGACG AACCTCCACAATCTCCTTGGGATAGAGTTA AGGACTTG-3 ’encoding amino acids from -6 to + 14 polypeptides and containing a translation initiation codon and modified codons for amino acids -6, -1, +1, +3. +4, +5. +6, +7, +10, +11 and +14. The modified DNA sequence obtained according to the method of the present invention finds important application in the construction of a cloning and expression vector containing this DNA sequence encoding human proapo A-Ι, which gives amplification and, therefore, expression of mature human proapo A-I and meta-proapo A-1; its fusion conjugates or its conjugates with an N-terminal signal, cultures of viable cells or genetically modified microorganisms. containing such vectors, and capable of producing human proapo A-1 polypeptides in a physical state other than that which is detected or isolated from. source or natural environment. The resulting human proapo A-1 is largely freed from conventional endogenous proteins and other starting materials and products.
    A protein produced by cells or microorganisms modified with a DNA sequence obtained according to the method of the present invention consists of or contains mature human proapo A-1. which in this case can be converted in vitro or in vivo into mature human apo A-1 by the proteolytic action of apo A-1 propeptidase. The resulting human proapo A-1 can be used as such for therapeutic purposes; meta-proapo A-1 may also be used if the presence of the methionyl radical is pharmaceutically acceptable, as this product can be naturally and effectively converted into a circulating blood stream by natural propeptidase, into an authentic mature human apo A-1. If desired, human proapo A-1 can be produced in selected microorganisms or cell cultures that are capable of acting on the N-terminal methionine, and therefore are capable of producing human proapo A-1 in a form not containing N-terminal methionine. In other words, human proapo A-1 contains or does not contain an N-terminal methionyl radical, can be cleaved in vitro to form mature human apo A-1, which can be used for therapeutic purposes. The same applies to fusion conjugates and conjugates, including proapo AI signaling terminal N; cleavage of this product leads to the formation of genuine human apo A-1. devoid of N-terminal methionine.
    It was found that effective expression can be guaranteed by appropriate modification of certain codons in the sequence encoding amino acids from -6 to +14 of human proapo A-1. The term appropriate modification in this context means that some natural codons are replaced by other codons, which, according to the genetic code, are the same amino acids and. in addition, this concept means that all modifications taken together lead to a reduction or even complete elimination of the formation of pin structures. It should be emphasized that such modifications of the DNA sequence do not have any effect on the type of propeptidase cleavage point because the amino acid sequence recognized by the propeptidase is retained in this construction.
    The protein produced is the product of a cell culture or genetically modified microorganism and can be presented in the form of mature proapo A-1, in the form of mature proapo A-1, which is preceded by a methionine radical, in the form of a fusion protein, such as, for example, beta. Galactosidase -proapo A-1, and in the form of a compound preproapo A-1.
    The cell or microorganism culture used for this production is not limited to cell lines and specific organisms: they can be used as prokaryotic cells. and eikaryotic cells, including animal and human cell lines. For the purpose of illustration only, an example is given below of expression in bacteria E coli (as representative of prokaryotic cells) and in yeast Saccharomvces cerevisiae. as well as in insect cells infected with baculovirus (as representatives of eikaristic cells).
    Replicated cloning vectors and expression vectors containing the DNA sequence. obtained according to the invention, and used in the examples are recombinant plasmids PUL B9291, p1 B9292.pu1 E9296, p1 B9299. pN IY612 and pN IY1613. the construction of which will be presented below. The first plasmids named, pul B9291 and pc1 B9292 contain a gene with a modified proapo A-Ι structure, which is preceded by the ATG codon, and which is controlled by the Ph promoter of the lambda phage. These plasmids are expression vectors. which are suitable for E. coli and direct the synthesis of human proapo A-1, which can be cleaved with propeptidase to form mature, authentic human apo A-1. At the input. h £, coli plasmid puL B9296 directs the expressed protein containing beta-galactosidase and human proapo A-1 under the control of the stimulator zone Jac, E. coli. Given that this fusion product also contains a propeptidase cleavage sequence, it can be cleaved to form an authentic mature human apo A-I.
    Plasmid puL B9299 is an expression vector suitable for yeast and contains the promoter and transcriptional terminator regions of ARG3. to guarantee effective expression in yeast. The resulting human proapo A-Ι can again be cleaved with propeptidase to form the authentic mature human apo AK
    Plasmid pN IY1612 contains a gene with the proapo A-структур structure fused to the DNA sequence of the signal peptide of the E. coli QmpA protein and under the control of the Ipp promoter (lioprotein) and the lac promoter operator. In this construction, the sequence encoding the gmpA signal peptide precedes the A-про proapo sequence without the ATG translation initiation codon. This plasmid is a secretion vector suitable for E. coll and directs the synthesis of human proapo AI, which can be secreted in periplasm without N-terminal methionine . Plasmid pN IY1613 is a transfer vector for introducing the DNA sequence of human proapo A-Ι into baculovirus. It includes the polyhedrine baculovirus promoter and a gene with the proapo A-структур structure, including the ATG translation initiation codon.
    Together with a natural source of baculovirus (nuclear polyhedriosis virus Autpqrapha californlpa AcNPN), plasmid pNIY1613 directs the synthesis of proapo A-1 "in insect cells and can again be released from methionine after post-translational modifications in insect cells.
    Depending on the type of vector used and on the selected host, any genetic technique suitable for achieving the desired genetic modification, including transfection, transduction, etc., can be used.
    This invention is carried out with strain MM 294 of the microorganism E, coll K12fendo Athi. hscLR. sup E); this strain was deposited was deposited in the American Type Culture Collection (ATCC No. 33625) without limitation on its availability.
    However, other microbial strains can be used, including known strains of E, colt, such as E. coil S, E. soi by 1776 (ATCC No. 31537. deposited July 3, 1979, without limitation). £. coll AR 58. derivative of No. 99 (ATCC No.
    33956) with clll. cl 857, bio lambda-free delta H functions supplied by PLPHARMACIA (YEMO ++ et al., Proc. Nntl. Acad Sci, USA. 82, 1985, pp. 88-92; G Devare et al., Cell, 36 1984 G., pp. 43-49), E. coli 1, M 101 (ATCC No. 33876) (1. Messing et al., Nucleis Acids Res 9, 1981, pp. 309-321), or E, coli J A221 (Ipp. HacM +. Trp E5, leu B6, lac Y, rec Al / F ', lac I, lac +, pro +) (J. Ghrayeb et al., EMBO J6 3. 1984 r „pp. 2437-2442 ), or other microbial strains, many of which are deposited and are available according to the regulations on the deposit of known microorganisms, such as microorganisms of American type cultures (ATCC) - see ATCC catalog lists. These microorganisms include, for example. Bacilli, such as Basillus subtills and other intestinal bacteria, from which, for example, Salmonella Typhimurium and Serratla marcesans can be named using plasmids that can replicate and express heterologous nenes sequences.
    Expression plasmids for use against bacteria, for example. E. coli. usually obtained from the plasmid pBR322, used as a vector (deposited in ATCC under the number 37017) and by inserting the heterologous gene sequence appropriately simultaneously with the signals of translation initiation and completion, in the reading phase, which exactly corresponds to the functional promoter, with the preferential selection of natural or artificially formed limit points. This vector will be the carrier of one or more characteristic phenotype selection genes and a replication source to guarantee amplification in the host. This heterologous insert can be re-expressed in such a way as to obtain expression simultaneously with the previous fused sequence, derived, for example, from genes of the lac system.
    • These baculovirus expression vectors, such as pAcRP6 and pAcYMI (J, Matsuura et al. J, Gen. viral, 68, 1987, p. 12331250) and wild-type baculovirus (Autographs catifornlca AcMPV nuclear polyhedrosis virus) are widely used . They are described in detail in the literature and can be obtained mainly according to the method used at the Texas experimental agricultural station.
    Various insect cells for compatible expression vectors can also be used as the host, for example Spodoptera frugiperda Sf9_ cells (MD Summer and GE Smith, Reference Guide to Techniques for Baculovirus and Insect Cell Culture Processing, University of Texas. Stash College, 1987, ATCC CRL 1711).
    Various yeast strains containing compatible expression vectors can be used, such as plasmid YR p7 (DT Stinchcomb et al. Nature. 282, 1979, pp. 39-43), which is capable of selection and replication simultaneously in E, coll and in yeast, in particular Saccharomyces cerevislae.
    Yeast strains that can be used are strain PH218 (G. Miozzari et al., J. Bacterio), 134, 1978, pp. 49-59, deposited in the American Type Culture Collection without limitation (ATCC No. 44076 ), strain 10S44c (T. Cabezon et al. Proc. Natl. Acad. Sci, USA, 81, 1984, pp. 6594-6598), which has the genotype leu 2-3, leu 2-112, pep 4 -3. (Μ. Hoylaerts et al. FEBS (ett, 204, 1986, pp. 83-87) and strain 1c 1697 d (arg J, leu 2-1 bradytrophic for arginine DATSS No. 20631).
    For the expression of a heterologous gene, such as DNAs for human proapo A-Ι in yeast, the construction of a 'plasmid vector comprising four constituent components is necessary. The first constituent component is a fragment that simultaneously transforms E. coli and yeast, and which must therefore contain a selection gene that originates from each organism.
    . It may be the gene responsible for ampicillin resistance that occurs otJE. coli (see Ampa) and the leu 2 gene. v originating from yeast. This constituent component also requires a source of replication originating from each organism in order to be preserved as plasmid DNA in these two organisms. This may be a source of E. coli, originating from pBR322 and a source of arsJ. yeast chromosome III or circular DNA replication source 2 μ.
    The second constituent component of the plasmid is the sequence located at position 5 'of the highly expressed yeast gene for transcription of the structural gene located below. This sequence. located at position 5 ’may be a sequence derived from yeast TDHJ or ARG3 genes. This fragment is constructed in such a way that it excludes the TDH3 or ARG3. Structural sequences, which are replaced by a sequence containing alternative restriction points, for example, Ncoj or BamHI restriction points, to favorably bind this sequence located at position 5 'to the structural gene.
    The third component of the system is a structural gene constructed in such a way that it contains both the ATG signal of translation initiation and the signal of completion of translation.
    The fourth component is the yeast DNA sequence containing the sequence located at position 3 ’of the yeast gene, which contains the corresponding signals for the termination of transcription and polyadenylation. For example, plasmids directing the production of · human proapro A-Ι in yeast can be constructed by inserting fragments of the human proapro A-1 polypeptide gene at the ΒΑηίΗΙ point of the plasmid expression pRIT 10774 described in European Patent Application No. 151102.
    Additional features of the present invention will be apparent from the following description of preferred vector constructs comprising the DNA sequence of the invention and the conditions under which these vectors can be useful. Next, a link will be given to the drawings in which:
    In FIG. 1a and b show the sequence of nucleotides and amino acids of the human preproapo A-Ι. The nucleotide sequence of the messenger RNA of human preproapo A-1 was determined based on DNA analysis of the DNA sequence of the DNA clone pULB1609. The amino acids present in the signal peptide, in the propeptide and in the mature apo A-1 polypeptide are identical and are numbered from the first amino acid group of the apo A-I protein.
    The area corresponding to the selected synthetic DNA sample used to isolate this clone is underlined. The letter abbreviations used to refer to amino acids have the following meanings: A. alanine; C, cysteine: D, aspartic acid; E, glutamic acid; F. phenylalanine; G. glycine: H, histidine; I, isoleucine, 'K, lysine; L, leucine; M, methionine; N, asparagine; R. proline; Q, glutamine; R, arginine; S, serine; T, threonine; V, valine: W. tryptophan; and Y, tyrosine.
    In FIG. Figure 2 shows the synthesis scheme of the oligonucleotide adapter for constructing a DNA fragment encoding the 6 amino acids of the propeptide and the first 14 amino acids of the mature apo A-l polypeptide with the ATG initiation codon. The arrows indicate the oligonucleotides used to synthesize the Ncol BACI fragment into 66/61 base pairs (bp). ”~
    In FIG. 3 shows the construction of the plasmid pUL B9291, which carries the regulatory zones of lambda PL and the nucleotide sequence of proapo A-1; in FIG. 4 - construction of the plasmid pUL B9296, which carries the lac promoter and E. coP nucleotide sequence of betagalactosidase. fused to the proapo A-1 sequence; in FIG. 5 - construction of plasmid pUL B9299. which carries the regulatory zones of yeast ABG3 and the proapo AI nucleotide sequence: FIG. 6a, b, c - construction of the plasmid pNIY16l2, which carries the regulatory zones Jac and Ipp, the sequence encoding the signal peptide otp A, and the nucleotide sequence of proapo AI; in FIG. 7 - construction of the plasmid pNIY 1613, which encompasses the regulatory zone of the polyhedrin gene and the nucleotide sequence of proapo A-1.
    Preparation of ribonucleic acids: Total liver ribonucleic acid is obtained from the chloride compound of guanidine (RA Cox, Methods in Enzymology, CP, Part B, 1968, pp. 120-129). This preparation of total ribonucleic acid (RNA) is then passed through a column of oligo (bT) celluloea to obtain total poly A + RNA (T. Manlatis et al. Molecular Cloning, Cold Spring Harba Laboratory Cold Spring Harbor. New York, 1982 g.). From 10 grams of the human liver, 200 μg of poly A + RNA is obtained.
    Synthesis of additional DNA (DNAc) in vitro.
    Reverse transcription reactions using 0.1-5 μg poly A + RNA as the starting material are carried out with oligo (dT) 12-18 (approximately 1 μg; source: BOEHRINGER). Then this single-stranded DNAs is converted into a double-stranded molecule (DNAs db) using the same reverse transcriptase as an enzyme. DNA preparations db. usually 1 μg, are treated with SI nuclease. with the formation of obvious ends. These procedures are well known to those skilled in the art and are similarly described by Manlatis et al., As mentioned above. Then, db DNAs are stretched by lengthening the oligo (dC) according to the method described by L.
    Vllla-Komaroff et al. (Proc. Natl. Acad Sci,
    USA, 75.1978, p. 3327-3731). Typically, 100 ng of DNA with db is treated with the enzyme terminal deoxynucleotidyl transferase.
    Usually, extensions corresponding to 15 bases are attached to the C3 'ends of the db DNA molecule.
    Cloning of extended db DNAs into the pBR 322 plasmid vector.
    The plasmid DNA pBR 322 is linearly aligned with the Pstl enzyme and stretched by oligo (dG) extensions according to the method described by R.M. Lawh et al., (Nucleic Acids Res. 9.1981, pp. 6103-6114).
    DNAs db. elongated by oligo (dC) extensions are mixed in uniform molecular proportions of the cDNA of plasmid pBR 322 extended by oligo (dG).
    Typically, 50 μg of the mixture hybridizes to plasmid recirculation. These conditions are well known to those skilled in the art and are described in detail in R.M. Lawn et al., Supra. This hybridization mixture is then used to transform competent cells, for example, strain E. coli strain MM294, according to the method described by R.M. Lawn et al., Supra. Several hundred transformants are obtained by growth selection in tetracycline medium. moreover, resistance to this antibiotic is reported by plasmid pBR 322. Transformants were also tested for their sensitivity to ampicillin. Those <of them. which showed sensitivity, contained a chimeric plasmid, since the insertion of foreign DNA into the vector inactivates the ampicillin gene.
    Qualifying screening of the bank. DNAs
    E. coli transformants are screened out using synthesized oligonucleotides. labeled at the 5 ′ end with the 32P isotope corresponding to the apo A-1 gene fragment. Such a nucleotide sequence of human ano A-! already known (see R. Chetng and L. Chan. see above, and J.J. Seifhamer et al., see above); thus, practically chemical synthesis is carried out according to the method of N.D. Sinda et al. (Nucleic Acids. Res.
    12. 1984, p. 4539-4557) a fragment of oligonucleotides in length. corresponding to 22 bases corresponding to the 5 ’end of the gene. The selected sequence is:
    5 '- GCTGCGGTGCTGACCTTGGCCG - 3'.
    Before using synthesized, the synthesized oligonucleotide is phosphorylated at its 5 'end by T4 polynucleotide kinase (P - L. Biochemicals and [gamma ~ 32P] adenosine thiophosphate. The labeling and hybridization conditions are well known to specialists in this field and are described in detail in T, Maniatis et al. , see above, as well as in the work of A. Bollen and flp., (DNA. 2.1983, p. 255-264).
    Construction of plasmid expression.
    Methods of obtaining DNA for the isolation of DNA fragments, as well as the conditions for analysis by restrictive enzymes and the conditions for linking fragments are well known to specialists in this field and are described in detail in R.M. Lawn and others, see above, and in the work of T. Cabezon and others, see above, and are used in this work.
    Synthesis of NCOI-Ball Fragments.
    Figure 2 shows in detail the principles underlying the concept of 35-dimensional, 30-dimensional, 18-dimensional and 43-dimensional oligonucleotides used in the synthesis of the NCOI-BAII fragment on 65/61 base pairs (pB). These synthesized 30-dimensional and 18-dimensional fragments are phosphorylated at their 5 'ends by means of T4 polynucleotidokinase (P-L Biochemicals). 1 μg of each oligonucleotide, including non-phosphorylated 35 - mer and 43 - mer. hybridize for three minutes at 95 ° C in 300 mmol of sodium acetate (pH ~ 7.0), then slowly cool at 4 ° C. The hybridization mixture is used as such in the cloning operation to construct expression plasmids.
    Determination of the amino acid sequence is easy. in D N10
    DNA sequence analysis is carried out according to the method described by A.M. Maxim and W. Gilbert (Proc. Matt. Acad Sci USA, 74, 1977, p. 560-564 and F. Sanger et al. (Proc. Natl. Acad. Sci, USA, 74. 1977, p. 5463-5467).
    Protein Analysis
    The accumulation of cells having an optical density in the range from 1 to 630 nm (IOD630) was obtained at various stages and during the fermentation of strains carrying plasmids expressing human proapo A-1, pul B9291, pul B9292, pul B9296 and pul B9299 (transformed respectively in strains AR58 and E. coli IM101, and in yeast strain 10S44c). Each sample was suspended in 50 mM Tris-HCI buffer. pH = 6.8. containing 2% sodium dodecyl sulfate (DSS). 6 Mol. urea, 10% glycerol and 5% 2-mercaptoethanol, and this buffer solution was heated at the boil for three minutes. Samples were subjected to polyacrylamide gel electrophoresis (U.K. Lac.mmli. Nature 227. 1970, 680-685). Common proteins were detected by blue Comassier staining, and the synthesized human proapo A-I was identified by immunological recognition after electrophoretic transfer (see A. Bollen et al., Above).
    Construction of recombinant vectors for the expression of human proapo A-i in bacteria, yeast and insect cells infected with baculovirus
    1. Clone DNAs for human preproapo A-ί: puf B1609 (Fig. 1).
    Several hundred transformants obtained by cloning db DNAs were selected. the corresponding poly A + RNA of the human liver, at the PStl point of plasmid pBR322. using the synthesized probe 22 - dimensional apo A – I described above. One of the clones gives an intense hybridization signal during the isolation, and this insertion of DNA present in the recombinant plasmid was characterized by analysis of the sequence of this DNA. Its length corresponds to 878 base pairs (Lp); it encodes the complete preproapo AI polypeptide. As shown in Figure 1, this cloned DNA fragment carries non-coding regions at the 5 'and 3' positions (19 bp and 55 bp, respectively), a sequence of 54 bp. encoding a peptide precursor (aa-24 to aa-7), a sequence of 18 br, encoding a propeptide (aa-6 to aa-1) and a sequence of 732 bp. encoding mature apo A-1 (aa + 1 to aa + 243), and includes a translation completion codon. This protein sequence, taken from the DNA sequence, exactly matches the amino acids found for A-Ι preproapo from this protein and from DNA clones isolated in isolation from each other (WC Na'ker et al. Comp. Biochem. Physiol 57B, 1977 ., p. 309-315; Japanese Patent Application No. 96998/86; R. Cheung and L. Chan, see above, and JJ Seilhamer et al., see above).
    2. Construction of a bacterial expression vector, including the DNA sequence of human proapo AI: pul B9291 (Figs. 2 and 3) ............................ ..
    The pul B9291 was built. a plasmid that produces human proapo A-1 by positioning a segment derived from clone pUL B1609, behind the regulatory promoter PL lambda (pnc. 3). The construction of this expression plasmid requires the synthesis of DNA fragments, including the NCOI ATC restriction point, a translation initiation codon and the nucleotide sequence encoding the amino acids from the aminated end of the gene with the structure of human proapo A-1, to the first unique restriction point, Ball (Fig. 2) ·
    Such an adapter is synthesized by chemical methods (N.D. Sinha et al., See above). Four synthesized oligonucleotides were obtained: after hybridization, they encode the methionine corresponding to the ATC translation initiation codon, for the six amino acids corresponding to the propeptide, and for the first 14 amino acids of mature human apo A-1 (Figure 2). This synthesized adapter serves to minimize the formation of secondary structures at the end of the 5 ’gene. For this, the codons selected for encoding the amino acid groups -6, -1, 1, 3.4, 5. 6. 6. 7, 10, 11 and 14 do not correspond to the natural codons found in the DNAs of clone pul B1609.
    The synthesized adapter described above is used to attach a 744 pb DNA fragment derived from pul B1609 to the PL lambda promoter in the expression plasmid pul B1221.
    The construction of the expression vector pul B1221 described in European patent application No. 186.643. It includes three main steps, starting from plasmid pCQV 2. Plasmid pCQV'2 is described by Queen C. in J. Mo1. Appt. Genet. 2.1983 N., pp. 1-10, and is readily available.
    The choice of this type of vector is optional: any other vector having a promoter and a suitable NCOI point located below it can be used. About 0.1 μg of the synthesized fragments, such as those described above, are crosslinked using T4 DNA ligase, from about 1 μg of the Ball fragment - RBg ^ at 744 pb, derived from pul B1609 and from about 1 μg of plasmid vector pUL B1221. cut off NCOI and Ball · Prior to the crosslinking operation, the Balt - PStl fragment at 744 pb of the main pair is processed with T4 DNA polymerase so that the elongated ends at position 3 are converted to free ends. This procedure is well known to specialists in this field and is described in detail by T. Manlatis et al., See above.
    After amplification in competent cells of strain AR58 E. coll, rearranged plasmids are characterized by analysis of restriction points and DNA sequence analysis of the synthesized fragments and connection points. The recombinant plasmid pUL B9291 meets all the criteria because it has fragments in the correct orientation and in the correct order. It is used to study expression.
    3. Construction of a bacterial expression vector containing fusion sequences corresponding to beta-galactosidase and human proapo A-1: pul B9296 (Fig. 4).
    In this construction, the DNA sequence encoding human proapo A-1 fuses in the correct reading phase below the beta-galactosidase DNA sequence. Betagalaktozidazy gene present in plasmid expressing E. coll pUR288, are readily available - (ΰ Ruther and Muller-HJII, EMBO J, 2, 1983, at 1971-1794.), Which carries efficiently inducible lac promoter, with appropriate restrictive point in the sequence beta-galactosidase. The corresponding recombinant plasmid was constructed as shown in the figure.
    4. First of all, the plasmid puR228 plasmid DNA is cut off with VAM, then it is treated with T4 DNA polymerase and SAIL is cut off again. Then, the 805 pb DNA fragment is separated from pUL B9291 by sequential alignment with Kpnl, processing of T4 DNA polymerase and final alignment with Sall. These two fragments are crosslinked to each other in molar proportions using T4 DNA ligase, and the resulting plasmid is used to transform competent cells of E. coli strain JM101, which is a widespread and readily available strain (ATCC No. 33876). Transformants are characterized by restrictive analysis on the correct orientation of the human pregap.ro A-последовательности sequence relative to the beta-galactosidase gene and the presence of a reproducible BamHt point at the junction of the two sequences. This shows that the human proapo sequence A-Ι is well fused below the beta-galactosidase DNA sequence and in the correct reading phase. One of the transformants containing the plasmid pulB9296 meets all the criteria and is used in expression determination experiments.
    4. Construction of an alazmide for expression of a yeast carrier of a DNA sequence from human proapo A I: pul B9299 (Fig. 5)
    In this construction, the DNA sequence encoding human propo A-1 is cloned between the promoter and terminator signals carried by the yeast expression plasmid. For the present experiment, this yeast expression vector pRIT 10774 was selected. Such a construction of the alazmide of the expression pRIT 10774 is described in European patent application 151.102. It is constructed, on the one hand, from plasmid pRTI 10749. deposited in ATCC under the number 39133. in accordance with the provisions of the Budapest Agreement, and, on the other hand, from the shuttle vector YEp13 for E. coP - S cerevllslal. described by J.R. Breach et al., Gem 8, 1979, pp. 121-133, and which is stored in ATCC under the number 37115 and is easily accessible. The pRIT 10774 vector can replicate simultaneously in E. coli and yeast and carries the promoter and transcription terminator ornithine carbamoyltransferase (ARG3), separated by a unique BamHI restriction point suitable for insertion of foreign DNA having its own ATG translation initiation codon. In addition, this vector carries 2 yeast sequences, metabolic markers for selection in yeast, and the ATPA selection mark for the shuttle vector in E. col. This is not the only vector that can be used to express human proapo Al in yeast: any other vector can be used for the yeast carrier of the regulatory signal, and this leads to qualitatively identical results. The construction illustrated in FIG. 5. carried out as follows. The plasmid DNA pRIT 10774 is linearly aligned with the BamHI enzyme and is treated with T4 DNA polymerase.
    On the other hand, an 810 pb DNA fragment is separated from pul B9291 by digestion with Asp718 and Sall enzymes, followed by T4 polymerase DNA treatment. This fragment encodes the human proapo AF and includes the ATG translation initiation codon. These two fragments, obtained as described above, are crosslinked to each other in equi-polar proportions using T4 ligase DNA, and this mixture is used to transform competent E, coli MM294 cells. The control of these transformants is carried out by restrictive analysis, which allows you to check the correct orientation of the DNA sequence of human proapo A-1 relative to the sequence of the ARG3 promoter. One of the transformants contains the recombinant plasmid pul B9299, which is suitable for this condition. Plasmid pul B9299 is amplified in E. coli and used to transform the spheroplast of the yeast Saccharomyces cerevlsiae strain 10 S44c (pp4-3-Ieu2-3, Ieu2-112) (T. Calezon et al., Supra). .
    The use of strain 1c 16976 (ATCC No. 20631) leads to qualitatively similar results. Yeast transformants are then tested for expression of the human proapo A-1.
    5. Construction of a large secretion vector, including a DNA sequence with a human ... program A-1: pNIY1612 (Fig. 6.6).
    In this construction, the DNA sequence encoding human proapo A-1 fuses in the correct reading phase below the DNA sequence of the signal peptide of the E. coli OmpA protein. For this experiment, the secretion vector pIN - III - ompA - 2 was selected (J. Ghrayeb and AP., EMBOJ, 3. 1984, p. 2437-2442). This vector is host E, coli TA221 is available and can be obtained from the Department of Biochemistry, State University of New York, Stony Brook.
    This secretion vector carries the strong Ipp promoter (lipoprotein), a fragment of the promoter operator jag, the sequence lacl_penpeccopaja.c_n corresponding restriction points located immediately after the sequence encoding the signal peptide of gene op_A. A suitable recombinant plasmid is constructed as shown in Figures 6a, bis. First of all, the secretion vector pNI - III - ompA - 2 is linearly aligned with EcoRI and processed with T4 DNA polymerase. Then, a 805 pb DNA fragment is extracted from pul B 9291 by sequential alignment with restrictive enzymes Kpnl and SAII, and subsequent processing of the DNA polymer with the Th T4. This fragment encodes the human proapo A-Ι and contains the ATG translation initiation codon. Both fragments, obtained as described above, are crosslinked to each other in uniform proportions using T-4 ligase DNA, and this crosslinked mixture is used to transform competent cells of strain JA221 E : coli cultured in M9 medium (JH Muller Molecular Genetics Experiments, Cold Spring Harbor Laboratory Cold Spring Harbor New York, 1972, p. 431). containing 20 mg / l tryptophan, 20 mg / l leucine, 2 g / l lactose and 50 mg / l ampicillin. These transformants were selected for their resistance to ampicillin and undergo screening with a '18 dimensional synthesized oligonucleotide (the same as that used in the synthesis of the adapter, as shown in Fig. 2).
    Selected transformants are monitored by restrictive analysis to verify the correct orientation of the proapo A-1 DNA sequence relative to the signal- sequence. peptide, the carrier of which is the secretion vector (reproducible ECO RI point at the junction of two sequences). One of the transformants carries a recombinant plasmid that meets this condition. Excessive sequence resulting from building with an adapter, underlined in the nukteotidny sequence below:
    5 'GTA GCG GAG GCC GCT GAA TT_C ATG AGA CAT TTC TGG 3 ’
    Vai Ala CIN Ala ΑΙΑ GIU Phe Met Arg HIs Phe Trp is eliminated by targeted AK-6 mutagenesis. For this purpose, the following 24-dimensional oligonucleotide is synthesized:
    signal peptide — t>, ‘* - praapo A-1 5’ GTA GCG GAG GCC ’AGA CAT TTC TGG 3’
    Vai Ala Gin Ala ARg His Phe Trp devoid of 12 unnecessary bases, and it is used to remove the unnecessary sequence of 12 bases, originating from the adapter.
    For the implementation of mutagenesis, the Amersham system is used. This system is based on the method of F. Eckstein et al. (Nucleic Acids Res. 13, 1985, 8765-8785). This method provides a high yield and the highest efficiency among existing methods: up to 95%.
    First of all, the region of DNA that is pre-mutagenized is cloned into the M13 vector. For this purpose, the Xbal - DaH DNA fragment of the recombinant plasmid pIN - III - ompA - 2, carrying the prozpo A-1 gene, is inserted into the MI3mpl9 vector, cut off by Xbal Hlndll. This vector MI3mpl9 is commercially available: it can be obtained according to the Amerscham (Buckinghamshire UK). Then, the mutagenic 24-dimensional oligonucleotide hybridizes with the single-chain matrix and is stretched by the Klenov fragment of the DNA polymerase in the presence of T4 ligase DNA to obtain a mutant heteroduplex.
    Selective removal of a non-mutant strand is possible due to the introduction of a thionucleotide into the mutant strand during synthesis in vitro and by cleavage of the NCII strand not subjected to fotorothianation. Such cleavages provide points for exonuclease III, which digests a non-mutant strand. In this case, the mutant strand is used as a matrix to rearrange a double-strand circular molecule, leading to the formation of a monoduplex mutant molecule. Such mutagenesis is confirmed by the sequence of the connection between the signal peptide and the start of the proapo A-1 gene. This recombinant plasmid pNIY16l2 is rearranged by cross-linking the Xbal - Hind III fragment into the pIN - III - ompA-2 vector with the Xbal - Bal I fragment, which is free from 12 unnecessary bases, and with the Bal I - Hind III fragment of the proapo A-I gene.
    These three fragments are linearly aligned by T4 DNA ligase, and this mixture is used to transform competent E cells, coil TF221, as described above. These transformants are selected for their resistance to ampicillin and sieved with the 18-dimensional oligonucleotide described above. One of the transformants carries the recombinant plasmid pNIY1612. In this final construction, the sequence encoding the ompA signal peptide precedes the complete proapo A-f sequence without the ATG codon (Fig. 6a, b, c).
    E. coli transformants are then tested for expression of human proapo A-1.
    6. Construction of a transfer vector for entering the DNA sequence of human proapo A-t into baculovirus: pNIY1613 (Fig. 7).
    Plasmid pNIY1613. the human DNA sequence of human proapo A-1, constructed by locating a segment derived from clone pul B9291, below the promoter of the polyhedrin gene of baculovirus (Fig. 7). In this experiment, the baculovirus pACpRb transfer vector is used (J. Matsnura et al., J. Gen, Virol 67. 1986, pp. 1515-1529); it can be obtained from the Department of Microbiology and Immunology of the University of Ottawa. This plasmid carries a polyhedrin hay promoter up to · nucleotide-7 in the leading sequence at position 5 ’; it lacks the ATG polyhedrin codon and the first 170 nucleotides of the polyhedrin coding sequence. , The desired Bam HI point is located below nucleotide 7. The construction illustrated in FIG. 7 is carried out as follows. The plasmid pAcRP6 DNA is linearly aligned by BamHI. In addition, an 810 pb DNA fragment was extracted from pul B9291 by alignment with restrictive enzymes ASp 718 and SAII. This fragment encodes the human proapo A-1 and contains the ATG codon of translation initiation. These two fragments in uniform polar proportions are jointly processed with T4 DNA polymerase, crosslinked using T4 DNA ligase and used to transform competent cells of E. coli strain AR58. These transformants are selected for their resistance to ampicillin, sieved by means of a 35-mer synthesized oligonucleotide labeled with 32p (see Fig. 2), corresponding to the DNA part of the proapo A-1 sequence. and they are controlled by restrictive analysis to verify the correct orientation of a given proapo A-1 DNA sequence relative to the 25 polyhedrin gene promoter. One of the transformants carries a recombinant plasmid. pNIY1613 that meets this condition; it is used in the analysis of this expression. thirty
    7. Production of human proapo A-культуры by transformed microorganisms, cultures consisting of 20 ml of strain E. coli AR58 or JM101, transformed respectively by pul B9291 and pUL B9296, are cultured in an enriched medium supplemented with 50 μg / ml ampicillin (culture broth LB, see T. Maniatls et al., Cited above, for conducting experiments (40 experiments) until an optical density of 0.6 to 630 nm is reached. In the case of pul B9291, the induction of the PL lambda promoter is carried out with the creation of initial culture growth conditions from 30 ° C to 42 ° C, 45 so that inhibition of the Pl lambda promoter suppressor occurs (M. Rorenberg et al. Methods Enzymol 101, 1983 ., pp. 123-138. Induction occurs 8 within 20 minutes.
    In the case of pul B9296, the lac promoter is induced by introducing into the culture incubated at 37 ° C the IPTG chemical inducer (ispropyl-beta-O-thiogalac-55 toside) until a final concentration of 1 mMol is reached (R. Lorenzetti and et al. above). Induction occurs within 60 minutes.
    On the other hand, cultures consisting of 20 ml of 10S44c yeast cells. transformed pul B9299, cultivated at 30 ° C in a medium of nitrated base 5 for yeast (Difco), supplemented with glucose (1%). until an optical density of 0.3-630 nm is reached. There is no need for any inductor, since in this particular case this expression is the main one.
    Samples were taken from 1 ml of the above cultures and centrifuged at 15,000 g for 5 minutes. The resulting precipitates are lysed in boiling sodium dodecyl sulfate 15 (DSS). These clusters are suspended in 50 μl of DSS-containing buffer. (50 mMol Tris-HC1, pH = 6.8. 2% DSS, 6 mol. Urea, 5% 2-mercaptoethanol and 10% glycerol) and this suspension is heated at the boil for 3 min at 100 ° С. The extracts are then centrifuged at 15,000 g for 10 minutes. These samples are thus ready for analysis by electrophoresis on polyacrylamide gels with a concentration of 15% or 7.5% in the presence of DSS, under denatured conditions of U.K. Laemmli, above).
    After electrophoresis, polyacrylamide gels are washed quickly with 40 milliliters of distillation water and 40 milliliters of sodium phosphate buffer solution (50 mMol) with a pH value of 7.5. Then these proteins are electrically transferred from the gels to the nitrocellulose sheet for two 35 hours at 60 Volts and 1.5 Amperes in the same phosphate buffer solution (T, Cabeezon et al., See above). Nitrocellulose sheets are saturated with albumin (1%) in 50 mM sodium phosphate buffered saline with pH = 7.5, then they are incubated at room temperature overnight and in the presence of rabbit anti-human apo A-сыворот serum with 1/500 dilution (and case of pul B9296 in the presence of monoclonal antibodies of mouse anti-beta-galactosidase) in the same buffer solution lacking albumin.
    These sheets are washed five times with 40 milliliters of the same phosphate buffer solution and then incubated in 40 ml of phosphate buffer solution containing 10 μg / ml of goat anti-rabbit (or anti-mouse antibody) serum and labeled in peroxidase. After four hours of incubation at room temperature, these sheets are washed five times again in 40 ml of phosphate buffered saline and finally appear by adding 50 ml of a chromogenic substrate solution (10 mg of diaminobenzidine. 100 μl of urea peroxide with a concentration of 10% and 100 mmol Tris-HCI with a pH value of 7 , 6). In the case of pul B9291 and pul B9299, a unique product is found that reacts with anti-human apo A-1 antibodies. This product has a molecular weight corresponding to the secy molecular reference natural apo A-1. In the case of pul B9296, a fusion polypeptide of the size provided for the sum of beta-galactosidase polypeptides and proapo A-1 (144 kDe) reacting with human anti-apo A-1 serum and anti-beta-galactosidase serum is detected. These sizes were determined previously using a calibration curve based on the migration of molecular weight standards located on the same gels as the cell extracts.
    In another experiment, cultures of 20 ml of a layer of E. coli JA221 transformed with PNIY1612 are cultured in an enriched medium supplemented with 50 μg / ml ampicillin (LB nutrient broth, see T, Manlatis et al., Above) until optical density is reached equal to from 0.6 to 630 nm. The induction of the lac promoter is carried out by introducing into the culture, incubated at 37 ° C, the IPTG chemical inducer (isopropyl-beta-O-thiogalactoside) until the final concentration is 2 mDl. Induction is carried out for 60 minutes. 1 ml samples of these cultures were taken and centrifuged at 15,000 g for 5 minutes. The resulting precipitates are collected through a small osmotic effect to release the periplasmoid fraction (D. Koshland and O. Botstel, Cell, 20. 1980, 749-760). The liberated fraction passes into suspension in a buffer solution of a sample containing DSS, mentioned above but not containing urea, the suspension is brought to a boil, centrifuged and subjected to polyacrylamide gel electrophoresis at a concentration of 12.5% in the presence of DSS followed by immunodetection after electrophoretic transfer. The fraction of synthesized proapo A-1 is detected in this cell, but not in the periplasm. This is due either to the fact that Proapo A-1 is not secreted, or to the fact that the effectiveness of the osmotic effect is not optimal. The main proapo fraction A-1 is found in a free state in this medium after osmotic exposure, thus indicating that the protein is well secreted by the cells.
    8. The production of human proapo Α-Ί by insect cells infected with baculovirus
    The recombinant plasmid pNIY1613 is used in conjunction with a wild strain of baculovirus to co-infect Spodoptora fruglperda cells in culture. 10 A sample of recombinant polyhedrin-free viruses resulted in recombinant colonies. The recombinant virus, purified from the colony, is used to infect insect cells. This procedure is well known to those skilled in the art and is described in detail by M.D. Summer and G.E. Snfth Reference Guide for Baculovirus Vector Techniques and Operations for 20 Insect Cell Culture. University of Texas College Station, 1987
    This recombinant virus was tested for the production of proapo A-Ι immunologically after electrophoretic 25 transfer and by polyacrylamide gel electrophoresis at a concentration of 12.5% in the presence of DSS, after lysing cells with RIPA buffer solution (0.05 mol buffer solution 30-Tris-HCI, pH = 7.2, containing 0.15 mol of NaCl, 1% Triton X100, 0.1% DSS, 0.1% sodium deoxycholate and 1 mM phenylmethylsulfonyl fluoride, FPMS), and treatment with boiling DSS. One 35 single product was found that reacted with anti-human apo A-1 antibodies. It has a molecular weight corresponding to the molecular weight of the natural apo A-1 ethanol, and this pronounced protein is the 40 major constituent component of the total proteins. The concentration of proapo A-1 per 1 liter of culture, measured by simple radial immunodiffusion (G. Man sin! Et al. Immunochem, 2.1965 g "235-254), is about 100 mg.
    9. Cytoplasmic production of human proapo A-Ι in E. coll
    Using a defined minimum environment
    For cytoplasmic production of human proapo A-Ι by E. coll in a minimal medium, plasmid pul B9292 was used. Plasmid put B9292 was constructed by exchanging 55 an EcoRI fragment — Ncol of the plasmid pul B9291 encoding the Pl lambda promoter with the same EcoRI fragment — Ncol of the pOTS plasmid (M. Resenberg et al. Methods-Enzymol 101, 1983, p. 123 -138). This snippet
    EcoRJ - Ncol of the pOTS vector (G. Sevare et al., CeP7 * ZbG1984 g, pp. 43-49) also contains an efficient and regulated Pt promoter, lambda phage. It is grown in a certain minimal culture medium of 20 ml of strain AR58 E, coll, transformed with plasmid pul B9292. The composition of the minimum medium (per liter) is as follows: 3 g MagnNROd 2NgO. 3 g of KH2RO4; 0.5 g of LeC1. 1 g of NH4CI, 1.37 mmol of MgSO4 7Η 2 Ο, 29.5 μmol, FeCl3 6Н2О, 236 μmol of MnSCM Н 2 О, 10 g of glucose, 1 mg of vitamin B 1.50 mg of ampicillin. culture broth LB 1/20 (v / v). Cells are cultured in this minimal medium until the optical density reaches a value from 0.5 to 630 nm. Induction of the Pt lambda promoter is carried out by maintaining the initial culture growth conditions from 30 to 42 ° C so as to inactivate the lambda Pi promoter suppressor (M. Rosenberg et al., Supra). Induction is carried out for 60 minutes. 1 ml of culture samples were taken and passed into a French press or centrifuged at 15,000 g for 5 minutes. The resulting total cell extract or pellet is subjected to boiling DSS, as described in section 7. After electrophoresis and electrophoretic transfer, one single product is found that reacts with antibodies - anti-human Apo A-1. The molecular weight of this product corresponds to the molecular weight of the reference natural apo A-1. The concentration of expressed proapolipoprotein A-1 in a certain minimal medium is 13.5% of the total proteins, or the established concentration of proapo A-Ι is approximately 270 mg per liter of culture.
    10. Extraction, purification and characterization of human proapo A-1 produced by transformed microorganisms
    10.1. Removing and cleaning.
    The crude extracts of recombinant proapo AI are centrifuged at 4.000 g for 15 minutes, and the precipitate is recovered. The surface layer is centrifuged at 100,000 g for two hours. The resulting precipitate is transferred into suspension in a minimum volume of a buffer solution (TEN 100) containing 20 mmol. Tris-HCI, pH = 7.5: 1 mmol ethylenediaminetetraacetic acid (EDTA), 100 mmol NaCl: 1.75 μg / ml FPMS and 100 μg / ml sodium thiolate (ethylmercury-thiosalicylic acid sodium salt), and the indicated volumes of suspension and the floated layer is separately brought from each other to the initial volume of the extract using the same buffer solution. The protein then precipitates from both suspensions at increasing concentrations of isopropyl alcohol. Using the radial immunodiffusion method (G. Manelnl et al., Supra), using the industrial standard apo A-1, the fraction of the precipitated protein of each suspension is determined, which makes up the bulk of the immunoreactivity corresponding to human apo A-1. Each fraction thus obtained was further purified by chromatography on a Sephacryl S200 column using the same buffer solution as eluent. The 0.9 ml fractions were collected, and the amount of total protein having immunoreactivity corresponding to the apo A-1 immunoreactivity was determined in each fraction by the method of radial immunodiffusion. The molecular weight of the protein eluted in these fractions is determined by calibrating the column using standards of known molecular weight, such as aldolase, bovine serum albumin, egg albumin, chymotrypsinogen and cytochrome C, under identical conditions. The purity of proapo A-1 per mg of total protein in the main fractions containing recombinant proapo A-1, expressed in mg of protein having the same immunoreactivity as the industrial standard apo A-1, is 95%.
    102. Description.
    102.1. Physical properties of recombinant soda
    By centrifugation at 100,000 g of recombinant pro-Apo A-Ι, purified and isolated from the surface layer and sediment, by isoelectric focalization according to the method of M. Catslmpoolas (Anal. Blochem, 26, 1969, pp. 54-62) and using autogenerated gradient with a pH value of 4 to 6, it turns out one single strip with an isoelectric point of 4.95. Plasma apo A-1 is slightly more acidic and has an isoelectric point of 4.75. This difference in pH equal to 0.2 between the isoelectric points of the recombinant apo A-1 and the plasma apo A-1 is very close in value to the already known difference between the isoelectric points of the plasma apo A-1, which, as previously reported, is 0.17 (GL Mills et al., Lab. Tech. Biochem, Mol. Biol, 14, 1984, pp. 244-245).
    As far as molecular weight is concerned, the recombinant proapo A-1 precipitate and surface layer both consist of a single polypeptide chain of identical molecular weight equal to 29.9 ± 1.4 kDa. Human Plasma Apo A-! has a slightly smaller chain length and its molecular weight is 29.3 ± 1.3 kDa.
    10.2,2, Determination of the peptide map of recombinant proapo A-1 by BlMPS-skatol,
    Chemical cleavage is carried out by 3-bromo-3-methyl-2 - {(2-nitrophenyl) thio] -ZH-indole (BNPS-scatol) according to method A. Fontana (Methods Enzymot 25, 1972, p. 419-423) . 5-10 μg of purified protein preparations are dissolved in 100 μl of phenol solution (0.15 vol / vol%). in an aqueous solution of 50% (v / v) acetic acid. Then, 50 μl of a solution of 4.8 mg of BNPS-skatol per ml of glacial acetic acid was added and incubated at 25 ° C for 72 hours. Then, 50 μl of 2-mercaptoethanol was added and incubated a second time for five hours at 37 ° C. Samples are evaporated, redissolved in 100 μl of water and extracted three times with 200 μl of ethyl acetate. Organically, the phases are removed and the aqueous phases are lyophilized and analyzed by polyacrylamide gel electrophoresis - DSS.
    In the case of chemical cleavage with a BNPS scatol, the number and size of fragments obtained from apo A-Ι can be predicted to one degree or another, if we take into account that under the experimental conditions used, the BNPS scatole selectively cuts off after the tryptophan group. Taking the efficiency at each cleavage point as 100%, the largest fragment that can be obtained is the C-terminal fragment with a molecular weight of 15.4 kDa. The molecular weights of the remaining fragments are in the range from 0.5 to 5.3 kDa, and therefore they are too small to detect them,
    In the case of incomplete splitting, the 15.4 kDa fragment will be elongated in the direction of the N-terminal end, forming respectively fragments with molecular weights of 20.7 kDa, 23.1 kDa, 27.6 kDa. Such suggestions are quite real for human plasma apo A-1, as well as for other purified preparations of recombinant proapo A-1.
    权利要求:
    Claims (3)
    [1]
    Claim
    A method of obtaining a DNA sequence containing a fragment encoding human proapolipoprotein A-1, comprising obtaining DNA clones by cloning a DNA fragment in pBR 322, selecting a clone encoding preproapolipoprotein A-1, isolating a DNA sequence from a selected clone, characterized in that, for ensure the best expression of human proapolipoprotein A-1. clone a cDNA fragment. obtained by ligation of a Ball - Pstl fragment of a DNA sequence encoding the amino acids +15 - +243 proapolypoprbtein A-с, with a synthetic fragment with the following DNA sequence: 5 '- ATG AGA CAT TTCTGGCAGGAGGACG AACSTCCACTAAT CCTTGGGATAGAGTTA AGGACTTG - 3 - +14 polypeptides and a translation initiation codon, as well as modified codons for amino acids -6, -1, +1, +3, +4, +5, + 6, + 7. +10, +11 and +14.
    10 20 50 “U 9) 6070
    M K A A V LT L A V I F L T 6 S 0 A R R ‘20 -V
    Yu 50 100 VO 120 VO 1931S)
    F W O O V E R F b S P W V R V K V L A Τ V Υ V BV L
    1 10 20
    160 170 180 193 200 210 220 230
    K B S 6 R B Y V «S B F E 6 S ALGKOLHLKtLD 30y ·.
    290
    [2]
    2S0 260 270
    Y006976С (Л№С £ АСОТ (ЖАШ : г »г <л
    280 290 300 310 Yushashpst & W / & UTB ^^
    N W B S V T S T F S K I R E O L 6 P V T O E F M B “L
    50 ® 70
    320 330 390 350 360 370 380 390
    E K E T E 6 t R O E M S-K L E E V KAKVOPYL
    U 93BO
    900 W 92D <00 990 950 960 970
    SHCHAT € SAM9ZH (US “EM ^
    D B FQ K K “0 E E I E IYR O K V E P LR A E L B IN a 120
    Figure 1
    433 units SD 510 S3) 530 540 550
    E 6 A R 0 K L Η E 1 b E K L S F L 6 E E AND RDRAR L
    In. . 140 150
    KO 570 580 590 600 610 620 650
    HVOALRTHLAPYSDELRCRLAARLEA
    160 1701J
    640 6S) 660 670 68) 690 700 software
    L K E K 6 6 A R L A E Υ N A K A T E “L S T I SE K
    190200
    720 730 740 750 760 770783
    СШШЬ0П06 «6ОТ ^
    AKPALEDLR06LLPVLESFKVSFLSA
    210 220 230
    790 800 810 820 830 840 8S0 - 860 burnt gas
    L E E Υ T K K L Η T O
    Y0 step
    870878
    SHASH666 site NeoI
    Figure 1 point S o ei
    5 "<------35-rere-----------------> 3 '5’ + - 30- ^ rc-> 3'
    CATG MA CAT PS TO CAG CM GAC GAA CCT CCA S LA TCT CCT TO GAT AGA GTT AM GAC PB 6
    [3]
    3¾ ---— lB-n ^ re ——> 5 '3 ‘<—-------- 03- ^ re> 5'
    TCT STA AM DOS OTS CTC CTG JV GGA GGI G IT AGA GGA ACC STA TCT GARDEN PS STS AM S g I
    Met Arg Ule Phe Trp Gin Gin »Anp Gin Ggo Ggo Gin -6 -3 -1" 41
    I
    I
    I ί
    ON 2 -termine-propeptide '• fifth methionine (aa_g-aa_y) <
    site de cllVane cleavage point of propaptidae A-I +3
    Mature
    Set fro Trp Avr Arj Vai Lyn Asp Lem A (le) ib +9 +12 +14
    Fig 2
    AmrA
    T 4 DNA polymerase
    T ^ DNA polymerase
    AmrA
    AmrA
    P 7
    P1N-1II 0HPA2 /
    PROAPO A-I
    Xbai
    ATG η I BalI proapo A-I stop
    Hindiii
    Bali stop
    XbaI HindI11 (f
    XbaI ATG Bal!
    i BalI mutagenesis regulated by oligonucleotides.
    reproapo STOP HindIII
    ATG
    Less than 72 osmo BalI. v stitching
    6 ι
    类似技术:
    公开号 | 公开日 | 专利标题
    SU1834904A3|1993-08-15|Method to produce sequence of dna with fragment, that is coding human proapolipoprotein &#34;a-1&#34;
    JP3145968B2|2001-03-12|Expression of biologically active PDGF-like factor in eukaryotic cells
    US5439818A|1995-08-08|DNA encoding human recombinant basic fibroblast growth factor
    KR970009935B1|1997-06-19|High level expression method of human erythropoietin gene in stably transfected mammalian cells
    JP2957974B2|1999-10-06|Method for producing protein having erythropoietin activity
    JP2568794B2|1997-01-08|Superoxide dismutase gene
    US5141742A|1992-08-25|Vaccines against melanoma
    EP0210189B1|1994-12-07|Recombinant alveolar surfactant protein
    US4769328A|1988-09-06|Expression of biologically active PDGF analogs in yeast
    EP0013828A1|1980-08-06|Recombinant DNA, hosts transformed with it and processes for the preparation of polypeptides
    JP2515399B2|1996-07-10|Human nerve growth factor
    IE980173A1|2000-02-23|Expression of human serum albumin in the methylotrophic yeasts.
    US4933280A|1990-06-12|Recombinant DNA sequence encoding Alveolar Surfactant Protein
    WO1986006100A1|1986-10-23|Human anti-inflammatory phospholipase inhibitor protein
    US5342764A|1994-08-30|Recombinant expression system for human anti-inflammatory phospholipase inhibitor protein
    WO1985005125A1|1985-11-21|Vectors for the expression of factor ix, cells transformed by said vectors and process for the preparation of factor ix
    JPH10262668A|1998-10-06|Dna sequence including protein-encoded sequence that coding for angiogenesis factor
    JP2770926B2|1998-07-02|Human placental angiogenesis inducer capable of promoting capillary endothelial cell protease synthesis, DNA synthesis and migration
    CA1340264C|1998-12-15|Recombinant dna expression of novel diuretic/vasodilator compounds
    EP0676412A1|1995-10-11|Purified human chondrocalcin, process for producing the same, and utilization thereof
    WO2006089455A1|2006-08-31|Targeting anti-tumour fusion protein containing adenovirus e4orf4 protein
    JPH0691833B2|1994-11-16|Method for producing polypeptide having diuretic effect
    HU204086B|1991-11-28|Process for producing non-human mammal animal interferons, dna sequemces coding form them and pharmaceutical compositions comprising sand interferons
    同族专利:
    公开号 | 公开日
    LT3600B|1995-12-27|
    DK175686B1|2005-01-17|
    DE3880739D1|1993-06-09|
    CN1031892C|1996-05-29|
    PL272698A1|1989-03-06|
    AU615654B2|1991-10-10|
    DK289688D0|1988-05-27|
    DK289688A|1988-11-29|
    IL86480D0|1988-11-15|
    LTIP828A|1995-02-27|
    UA19765A|1997-12-25|
    FI882456A|1988-11-29|
    EG19101A|1994-09-29|
    PT87562A|1989-05-31|
    RU2009198C1|1994-03-15|
    ES2054878T3|1994-08-16|
    SG131594G|1995-01-13|
    JPS6416589A|1989-01-20|
    SK363888A3|1998-07-08|
    IE62422B1|1995-02-08|
    DE3880739T2|1993-08-19|
    LV5288A3|1993-10-10|
    KR880014110A|1988-12-22|
    CN88103118A|1988-12-14|
    AT89006T|1993-05-15|
    NZ224808A|1990-01-29|
    HK137794A|1994-12-16|
    CZ363888A3|1998-02-18|
    IL86480A|1992-08-18|
    GB8712540D0|1987-07-01|
    AU1672388A|1988-12-01|
    CA1323851C|1993-11-02|
    IE881597L|1988-11-28|
    DD291093A5|1991-06-20|
    KR970000808B1|1997-01-20|
    NO882341D0|1988-05-27|
    NO179253C|1996-09-04|
    SK279166B6|1998-07-08|
    PT87562B|1992-09-30|
    ZA883824B|1989-02-22|
    NO882341L|1988-11-29|
    HU204562B|1992-01-28|
    NO179253B|1996-05-28|
    EP0293357B1|1993-05-05|
    US5059528A|1991-10-22|
    PL158064B1|1992-07-31|
    EP0293357A1|1988-11-30|
    HUT47153A|1989-01-30|
    CZ283648B6|1998-05-13|
    FI882456A0|1988-05-25|
    FI100056B|1997-09-15|
    CY1809A|1995-10-20|
    JP2634193B2|1997-07-23|
    引用文献:
    公开号 | 申请日 | 公开日 | 申请人 | 专利标题
    RU2650510C2|2013-05-01|2018-04-16|Ионис Фармасьютикалз, Инк.|Compositions and methods of modulating apolipoprotein c-iii expression|AU587989B2|1984-10-16|1989-09-07|Mitsubishi Chemical Corporation|DMA fragments, expression vectors, proteins, hosts, and process for production of the proteins|
    JPH0549839B2|1984-10-18|1993-07-27|Matsushita Electric Ind Co Ltd|
    BE901119A|1984-11-23|1985-03-15|Wallone Region|PROCESS FOR THE PREPARATION OF VECTOR PLASMIDS CAPABLE OF TRANSFORMING A BACTERIAL HOST ESCHERICHIA COLI AND OF PROMOTING AND CONTROLLING THE EXPRESSION OF HETEROLOGOUS DNA IN IT.|
    AT89314T|1985-02-13|1993-05-15|Scios Nova Inc|HUMAN METALLOTHIONEIN II PROMOTOR IN MAMMAL EXPRESSION SYSTEMS.|
    GB8507833D0|1985-03-26|1985-05-01|Biogen Nv|Production of human somatomedin c|
    WO1987002062A1|1985-10-04|1987-04-09|Biotechnology Research Partners, Ltd.|Recombinant apolipoproteins and methods|
    GB8625435D0|1986-10-23|1986-11-26|Erba Farmitalia|Human apolipoprotein ai|
    WO1988003175A1|1986-10-29|1988-05-05|Biotechnology Research Partners, Ltd.|Apoai-ciii-aiv, apoaii, apob, apoci, and ldl receptor polymorphisms for genetic fingerprinting and predictive of atherosclerosis|AU587989B2|1984-10-16|1989-09-07|Mitsubishi Chemical Corporation|DMA fragments, expression vectors, proteins, hosts, and process for production of the proteins|
    JP2606228B2|1987-09-18|1997-04-30|三菱化学株式会社|Method for producing human proapolipoprotein AI-like protein|
    EP0345155B1|1988-05-31|1994-08-10|Mitsubishi Kasei Corporation|Process for producing natural human apolipoprotein e-like proteins|
    US5846799A|1988-06-14|1998-12-08|La Region Wallone|Human myeloperoxidase and its therapeutic application|
    US5460961A|1988-06-14|1995-10-24|La Region Wallonne|Human myeloperoxidase and its therapeutic application|
    IT1229996B|1989-04-20|1991-09-20|Cesare Sirtori|EXPRESSION OF APOLIPOPROTEIN AI AND APOLIPOPROTEIN AI-MILAN IN YEAST AND PHARMACEUTICAL COMPOSITIONS CONTAINING THESE APOLIPOPROTEINS.|
    AT158816T|1990-11-26|1997-10-15|Genetics Inst|EXPRESSION OF PACE IN HOST CELLS AND METHOD FOR USE THEREOF|
    US5844097A|1990-11-30|1998-12-01|Monoclonetics International, Inc.|Methods for the diagnosis of peripheral nerve damage|
    DK0559795T3|1990-11-30|1996-01-29|Monoclonetics Int|Methods for diagnosing chronic pain in the lumbar region and cervical spine|
    SE9500778D0|1995-03-03|1995-03-03|Pharmacia Ab|Process for producing a protein|
    US5994061A|1995-09-29|1999-11-30|Queen's University At Kingston|DNA constructs and methods for screening for increased expression of human apo AI gene|
    SE9603068D0|1996-08-23|1996-08-23|Pharmacia & Upjohn Ab|Process for purifying a protein|
    SE9603303D0|1996-09-11|1996-09-11|Pharmacia & Upjohn Ab|Process for purifying a protein|
    SE9603304D0|1996-09-11|1996-09-11|Pharmacia & Upjohn Ab|Process for purifying a compound|
    KR100330355B1|1999-06-04|2002-04-01|장인순|Duct type spacer grid with swirl flow vane in nuclear fuel assembly|
    US20040047853A1|2000-06-09|2004-03-11|Dahl Soren W|Purified proenzyme of dipeptidyl peptidase i |
    US6579710B2|2000-12-12|2003-06-17|Lexicon Genetics Incorporated|Human kinases and polynucleotides encoding the same|
    KR100560102B1|2004-06-25|2006-03-13|한국생명공학연구원|Prophylactic and therapeutic agents containing point mutants of proapolipoprotein A-I for anti-atherosclerosis and anti-hyperlipidemia|
    US7427662B2|2005-02-01|2008-09-23|Baord Of Supervisors Of Louisiana State University And Agricultural And Mechanical College|Inhibition of angiogenesis and destruction of angiogenic vessels by apolipoprotein A-I and high density lipoprotein|
    US8206750B2|2005-03-24|2012-06-26|Cerenis Therapeutics Holding S.A.|Charged lipoprotein complexes and their uses|
    JP2009505652A|2005-08-26|2009-02-12|セレニスセラピューティクスホールディングエスア|Compositions and methods for producing apolipoprotein gene products in lactic acid bacteria|
    US20080293102A1|2007-02-28|2008-11-27|Cerenis Therapeutics Holding, S.A.|Compositions and methods for producing apolipoprotein|
    KR101770435B1|2008-10-03|2017-09-05|큐알엔에이, 인크.|Treatment of apolipoprotein-a1 related diseases by inhibition of natural antisense transcript to apolipoproteina1|
    WO2010054401A1|2008-11-10|2010-05-14|Alnylam Pharmaceuticals, Inc.|Novel lipids and compositions for the delivery of therapeutics|
    CA2751342C|2009-01-29|2019-05-07|Alnylam Pharmaceuticals, Inc.|Lipid formulations comprising cationic lipid and a targeting lipid comprising n-acetyl galactosamine for delivery of nucleic acid|
    JP6032724B2|2009-03-12|2016-11-30|アルナイラム ファーマシューティカルズ， インコーポレイテッドＡｌｎｙｌａｍ Ｐｈａｒｍａｃｅｕｔｉｃａｌｓ， Ｉｎｃ．|Lipid preparation composition and method for inhibiting expression of Eg5 gene and VEGF gene|
    CA2760776C|2009-05-05|2019-07-09|Alnylam Pharmaceuticals, Inc.|Lipid compositions for the delivery of therapeutic agents|
    CN106237345A|2009-05-06|2016-12-21|库尔纳公司|By suppression therapy lipid transfer and the metabolic gene relevant disease of the natural antisense transcript for lipid transfer and metabolic gene|
    LT3431076T|2009-06-10|2021-10-25|Arbutus Biopharma Corporation|Improved lipid formulation|
    AP2015008874A0|2009-08-14|2015-11-30|Alnylam Pharmaceuticals Inc|Lipid formulated compositions and methods for inhibiting expression of a gene from the ebola virus|
    US10525152B2|2009-10-09|2020-01-07|Signablok, Inc.|Methods and compositions for targeted imaging|
    AU2010328336B2|2009-12-07|2017-03-02|Arbutus Biopharma Corporation|Compositions for nucleic acid delivery|
    US20130017223A1|2009-12-18|2013-01-17|The University Of British Columbia|Methods and compositions for delivery of nucleic acids|
    US20130156845A1|2010-04-29|2013-06-20|Alnylam Pharmaceuticals, Inc.|Lipid formulated single stranded rna|
    WO2011143362A1|2010-05-11|2011-11-17|Esperion Therapeutics, Inc.|Dimeric oxidation-resistant apolipoprotein a1 variants|
    KR101967411B1|2010-06-03|2019-04-10|알닐람 파마슈티칼스 인코포레이티드|Biodegradable lipids for the delivery of active agents|
    US20130202652A1|2010-07-30|2013-08-08|Alnylam Pharmaceuticals, Inc.|Methods and compositions for delivery of active agents|
    US20130323269A1|2010-07-30|2013-12-05|Muthiah Manoharan|Methods and compositions for delivery of active agents|
    WO2012064824A1|2010-11-09|2012-05-18|Alnylam Pharmaceuticals, Inc.|Lipid formulated compositions and methods for inhibiting expression of eg5 and vegf genes|
    DK3202760T3|2011-01-11|2019-11-25|Alnylam Pharmaceuticals Inc|PEGYLED LIPIDS AND THEIR USE FOR PHARMACEUTICAL SUPPLY|
    PT2673296T|2011-02-07|2019-01-31|Cerenis Therapeutics Holding Sa|Lipoprotein complexes and manufacturing and uses thereof|
    WO2013049328A1|2011-09-27|2013-04-04|Alnylam Pharmaceuticals, Inc.|Di-aliphatic substituted pegylated lipids|
    US10894098B2|2012-04-09|2021-01-19|Signablok, Inc.|Methods and compositions for targeted imaging|
    US9610324B2|2012-07-11|2017-04-04|Esperion Therapeutics, Inc.|Apolipoprotein mixtures|
    EP2853259A1|2013-09-30|2015-04-01|Université Pierre et Marie Curie |Reconstituted high density lipoproteins composition and uses thereof|
    AU2015260929A1|2014-05-02|2016-12-15|Cerenis Therapeutics Holding Sa|HDL therapy markers|
    US20190338282A1|2016-10-27|2019-11-07|Institute Of Microbiology, Chinese Academy Of Sciences|Method for modifying amino acid attenuator and use of same in production|
    WO2019030574A1|2017-08-10|2019-02-14|Cerenis Therapeutics Holding|Cargomers|
    TW201919686A|2017-08-10|2019-06-01|法商塞勒尼斯醫療控股公司|Apomers|
    US11164065B2|2018-08-24|2021-11-02|Bright Marbles, Inc.|Ideation virtual assistant tools|
    US11081113B2|2018-08-24|2021-08-03|Bright Marbles, Inc.|Idea scoring for creativity tool selection|
    US11189267B2|2018-08-24|2021-11-30|Bright Marbles, Inc.|Intelligence-driven virtual assistant for automated idea documentation|
    WO2021209823A1|2020-04-16|2021-10-21|Abionyx Pharma Sa|Methods for treating acute conditions using lipid binding protein- based complexes|
    法律状态:
    优先权:
    申请号 | 申请日 | 专利标题
    GB878712540A|GB8712540D0|1987-05-28|1987-05-28|Expression of human proapolipoprotein a-i|
    [返回顶部]